|
 
Email us: info@bioinforx.com
Call Us: (608) 467-4936
BxChIPSeq is Ready to Use.
Try It Out Immediately!
* Indicates required field
* First Name:
* Last Name:
* Email:
* Phone:
* Organization:
Password will be sent to your email account.
 

BxChIPSeq is a web-based ChIP-Seq data management and ChIP-Seq analysis system service for researchers who need to organize ChIP-Seq data efficiently and get ChIP-Seq data analyzed instantly.

BxChIPSeq organizes ChIP-Seq data into projects for online ChIP-Seq analysis with predefined or custom procedures. All ChIP-Seq analysis procedures are optimized and highly automated; even novice users with limited knowledge of ChIP-Seq data analysis can complete initial analysis quickly.

 
Overview
Why BxChIPSeq™?
Key Features
How It Works?
Analysis Preview
Pricing

 

Overview

BxChIPSeq does automated advanced chip sequence analysis with modern web based technology to provide a powerful system for performing next generation DNA sequence analysis. ChIP-Seq supports all ChIP-Seq platforms, including Illumina, Solexa, and ABI SOLiD. It supports all Life Technologies SOLiD and Illumina Genome Analyzers including Illumina Genome Analyzer I, II, IIx, IIe, as wells as the new Illumina HiSeq system 2000.

BxChIPSeq organizes ChIP-Seq data into projects for online ChIP-Seq analysis with predefined or custom procedures. All ChIP-Seq analysis procedures are optimized and highly automated; even novice users with limited knowledge of ChIP-Seq data analysis can complete initial analysis quickly. Quickly identify sequencing issues and sample prep by viewing and comparing unique vs. repetitive mapping, low quality, poly-A, control sequence, PCR bottlenecking, ribosomal RNA, and linker contamination.


BxChIPSeq Handles Your ChIP-Seq Data Management

It comes with integrated data management tools for experiments, projects, samples, contacts and analysis results. It is an ideal system for both academic laboratories and biotechnology companies to manage samples and experimental details.


BxChIPSeq Handles Your ChIP-Seq Data Analysis

Easy to use yet powerful analysis tools streamline this overwhelming process by taking millions of raw sequencing reads and transforming them into meaningful and easy-to-visualize data. All results can be visualized through the integrated UCSC genome browser. BxChIPSeq allows you to find transcription factor binding site, chromatin modifications, enrichment quantification of other factors, RNA-seq transcriptome-based expression profiling, RNA-seq alternative splicing discovery and quantification, and 3SEQ - 3'-end sequencing for expression quantification.


BxChIPSeq Makes ChIP-Seq Research as Simple and Fast as possible


  • Use it with any ChIP-Seq platform including Illumina, Solexa, and ABI SOLiD.

  • BxChIPSeq uses advanced data analysis algorithms supported by leading ChIP-Seq researchers and biostatisticians.


Perform Analysis Fast

  • Quick analysis with results ready in hours for rapid turnaround of ChIP-Seq data analysis.

  • Perform analysis on any type of ChIP-Seq data and use peak finder tools to find peaks fast.

  • Perform significance analysis of ChIP-Seq gene expression data using many statistical analysis tests including t-test, ANOVA tests, and many more.


Easy to use

  • No previous knowledge of ChIP-Seq data analysis is required, let our automated system do it for you.

  • No programming is necessary and you can even run custom data analysis scripts.

  • Easy to use data management tools allow easy data sharing and fast re-analysis with different parameters.


View Results

  • Get an easy to read summary of unique match tags, multiple matched tags and unmatched tags.

  • Use whole genome sliding window analysis with density plots along with sequence depth normalization, input filtering, and other statistics analysis.

  • Convert density plots and peak files to bed/wig/gff formats for loading into UCSC Genome Browser or other visualization tools.


Go Even Further

  • Converts raw instrument output files to formats ready for the data processing pipeline so you can download all final analysis data files and run further analysis if you want.

  • Supports custom ChIP-Seq analysis procedures, so it can integrate well with your current protocols.

  • Tags sequence alignment to genome or custom targets.

Key Features

  • Complete data analysis service provided by BioInfoRx, from converting output file formats to reporting analysis results.

  • Rapid turnaround of data analysis.

  • Supports Illumina/Solexa, ABI SOLiD, and other instruments.

  • Integrated with leading third party tools, such as UCSC Genome Browser.

  • Fully integrated with other BxLIMS systems for downstream functional analysis.

  • Supported by leading ChIP-Seq researchers and biostatisticians.

  • Continuously improved by incorporating novel statistics algorithms.

How It Works?


Step 1.

Step 2.

Step 3.

Step 4.

Step 5.

Step 6.

Step 7.

Step 8.

Step 9.

Step 10.

Step 11.

Screenshots

 

Designed with BxLIMS technology

BxChiPSeq's excellent data management and sharing functions can manage ChiP-Seq data including projects, samples, raw ChiP-Seq data files, and analysis results. BxChiPSeq comes with three highly automated and seamlessly integrated data analysis programs and a one-step data analysis tool. The ChiP-Seq data can be from users’ own experiments from published data.

 

BxChiPSeq is a novel ChiP-Seq data analysis and ChiP-Seq data sharing system.

Its easy-to-use tools help both novice and experienced users perform initial analysis of their ChiP-Seq data from the location of data storage. BxChiPSeq tools are also valuable for re-analyzing published ChiP-Seq data. BxChiPSeq is a useful system for facilities with ChiP-Seq services and laboratories involved with ChiP-Seq data analysis.

 

Control ChiP-Seq Data Files Visually

BxChiPSeq contains built-in explorer-like online file management and group-based file sharing tools. While file owners have full control of their files (e.g. create new folders and files, rename or delete existing folders and files), group members can read, copy, and download others’ files, but are not allowed to make changes.

 

Organize and Find Your Data Easily

BxChiPSeq contains a full-featured project and result search and browse tool. Users can browse project information page by page, update the viewing options, perform advanced searches, and download data in spreadsheet format.

 

Analyze All Published ChiP-Seq Data in a Few Clicks

Users can search for published ChiP-Seq data and create BxChiPSeq projects to analyze previously published data. The sample information is automatically populated in the project based on the subset information.

 

Analyze All Sorts of ChiP-Seq Data FAST

Use Express Analysis to perform data analysis in minutes. Default analysis methods and parameters can be used directly due to our built-in logic. Experienced users have the option to select methods and enter specific analysis parameters. BxChiPSeq presents online directly. The resulting files, including executed scripts and execution logs, are classified, listed, hyper-linked, and compressed in one file for easy downloading.

Analysis Preview

Online ChIP-Seq Data Processing

In this demo, we are going to perform several analyses including global peak shift estimation, local peak shift estimation, strand correlation values, tag oversampling, Q-values for regions and Q-values for peaks, using our test ChIP-Seq data. The result files are automatically uploaded to the UCSC server, and can be visualized using UCSC Genome Browser.

Please review the following analysis options and click Start Analysis button to review the demo analysis results.
 
Project Name:
Species: What is this?
Platform: What is this?
ChIP Type: What is this?
FDR Calculation: Yes No What is this?
Peak Call: What is this?
   
No. Sample Name Control Treatment Ignore Sample Format (What is this?)
1 Experiment.txt (350MB)
2 Control.txt (832MB)


Species

The following species are currently supported in BxChIPSeq:
  • Human
  • Mouse
  • Rat

If your species is not listed here, please contact us for details.

Platform

The following platforms are currently supported in BxChIPSeq:
  • Illumina/Solexa
  • ABI SOLiD
  • 454
  • HeliScope

If your platform is not listed here, please contact us for details.

ChIP-Type

The type of ChIP experiment
  1. Transcription Factor-like:
    Transcription factor with defined motif and narrow binding site resulting in regions of enrichment 100-300 bp wide.
    (bandwidth = 30 bp, region size = 300 bp)
  2. PolII-like:
    PolII-like factor resulting in regions of enrichment 300-1000 bp with some narrow binding sites and some wide sites possibly occupying the entire gene length.
    (bandwidth = 60 bp, region size = 600 bp)
  3. Histone-type:
    Histone-type ChIP resulting in wide regions of enrichment 1Kb and up possibly occupying multiple genes.
    (bandwidth = 100 bp, region size = 1000 bp)

If your ChIP experiment type is not listed here, please contact us for details.

Peak Call

Here is the details of the Peak Call:

  Enrichment Background Enrichment
(if applicable)		 Extension
Enrichment
Stringent 50 3 3
Recommended 30 3 3
Relaxed 10 2.5 3

If you would like to have a different combination, please contact us for details.

FDR Calculation

False discovery rate (FDR) control is a statistical method used in multiple hypothesis testing to correct for multiple comparisons. In a list of rejected hypotheses, FDR controls the expected proportion of incorrectly rejected null hypotheses (type I errors). It is a less conservative procedure for comparison, with greater power than familywise error rate (FWER) control, at a cost of increasing the likelihood of obtaining type I errors.

In practical terms, the FDR is the expected false positive rate; for example, if 1000 observations were experimentally predicted to be different, and a maximum FDR for these observations was 0.10, then 100 of these observations would be expected to be false positives.

The q value is defined to be the FDR analogue of the p-value. The q-value of an individual hypothesis test is the minimum FDR at which the test may be called significant. One approach is to directly estimate q-values rather than fixing a level at which to control the FDR.

» Read more on Wikipedia

Data Format

The following alignment formats are currently supported in BxChIPSeq:
  • Solexa/Illumina Align (Example Format)
    Definition:
    <DNA sequence> X X <chromosome:coordinate> <F/R> where X can be anything as long as it is presented.

    Example:
    GACTACACCTCTAACCACTACCATC 1250 1 chr4:72788542 F

  • Eland Align (Example Format)
    Definition:
    X <DNA sequence> X X X X <chrom_name.fa> <coordinate> <F/R>

    where X can be anything as long as it is presented.

    Example:
    HWI-EAS105_4:4:1:1664:1790 GAAAAGAACTGAAGGATCTCAAAAAT U1 0 1 0 chr1.fa 37883447 F DD 1C

  • Eland Extended Align (Example Format)
    Example:
    HWUSI-EAS270R:5:1:0:372#0/1 NGTCTCACTGGCAAATCCATTCCCTCACTGACATGA 1:1:1 chr4.fa:135597163RA13G11G3TGG1TG,chr8.fa:113733968FG35

  • Bowtie Align (Example Format)
    Note that the data generated using -z option is not supported.
    Example:
    18213 + chrX 19506600 CTGGTGTTAATGTTCAAGCTGTCTCTGGCTGGAGCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 21

  • MAQ Align (Example Format)
    Example:
    HWUSI-EAS270R:5:59:47:243#0/1 chr10 3000454 - 0 0 0 0 0 0 0 9 18 36 AAGCTGTTTTCCTGCTACTCTCTGAGCCTGCTACCC _\^`^`WP]\^`]^`\V`Z`\`\`Z```XX``T```

  • QuEST Align (Example Format)
    Definition:
    <chromosome> <coordinate> <+/->

    Example:
    chr4:72788542 +

If your alignment format is not listed here, please contact us for details.

ChIP-Seq Data Analysis Result (not complete list):
Your ChIP-Seq data analysis is finished. You can easily visualize the results with the UCSC Genome browser which is the best way to see your results and find ChIP-Seq peaks.
 
ChIP Calls Filtered: ChIP_calls.filtered.bed (1.15MB, Click to download)
  Click here to view the results using UCSC Genome browser.
     
Normalized Results: MyChipName_normalized.profile.wig.gz (39.83MB, Click to download)
  Click here to view the results using UCSC Genome browser.
   
     
 
Input Files:
All Output Files:
(Double click to download)